> ## Documentation Index > Fetch the complete documentation index at: https://docs.scispot.com/llms.txt > Use this file to discover all available pages before exploring further. # Create Sequences in Bulk > Create sequences of any type in bulk. This endpoint supports all sequence types. Each item in `sequences` requires a `name` and one of `sequence` | `sequenceData`; `type` (default DNA), `circular`, `description`, and `uuid` are optional per item. Note: feature arrays (features/parts/primers/guides/etc.) are not accepted here — canonical creation synthesizes empty feature sets. Use POST /sequences/{uuid}/annotations to add annotations afterward. ## OpenAPI ````yaml /api-docs.yaml post /sequences/bulk openapi: 3.0.0 info: title: Scispot's API Documentation description: >- ### [Welcome! Feel Free To Visit Scispot.com](https://www.scispot.com) #### Overview This is a documentation listing API calls for the following Scispot applications: 1. Labsheets (LIMS) 2. ELN 3. Manifests (plates, boxes, racks, etc.) 4. Sequences ## [Getting Started](https://labsheets.scispot.io/#getting-started) ### [Create a new API Key in account settings](https://labsheets.scispot.io/) - Go to [Scispot](https://labsheets.scispot.io) - Click on the "Account" button in the navigation bar on the bottom left corner of your screen - Click "Personal Tokens" on the left side of the pop-up modal - Click "Generate New Token" - Name your token, select token access, and click "Generate" - Copy the API Key and save it somewhere safe - this token cannot be retrieved once it is generated - This token will be used as "apiKey" in all API requests version: 1.0.0 servers: - url: https://cloudlab.scispot.io description: Scispot Cloud Lab security: - bearerAuth: [] tags: - name: Scispot API - name: Scispot API - LABSHEETS (LIMS) API description: >- #### Overview The following API calls are for the manipulation of Labsheets data. #### Terminology - **Labsheet** - A labsheet is a table that can be used to store and organize data. Labsheets can be created or manipulated in Scispot via GUI or API. - **Uuid** - Row uuids are unique identifiers for each labsheet row used in request and response bodies. Row uuids can be found using the Get Row Data endpoint and used in other endpoint requests to manipulate specific rows. - **ID** - IDs are user-defined values that can be used to identify rows in a labsheet. Create row IDs in labsheets by adding a column with type "ID" to your labsheet. The Update Row Data By ID Column endpoint uses IDs to update rows in a labsheet. - **Column Data Types** - These are data types set for each column in a labsheet and can be viewed in a labsheet's manage view menu, under the columns tab. - name: Scispot API - ELN API description: >- #### Overview The following API calls are for the manipulation of ELN data. #### Terminology - **Labspace** - "Labspace" is analogous to a directory or workspace. A labspace can contain folders,experiments, protocols and/or documentation pages. Labspaces can be created and manipulated through via GUI or API. - **Folder** - "Folder" is similar to a traditional folder. It allows users to organize their data inside different "Labspaces". - **Protocol** - A protocol is a base object used to store and organize protocol data. It is analogous to a page in a traditional laboratory record. - **Experiment** - An experiment is a base object used to store and organize experiment data and related protocols. It is also analogous to a page in a traditional laboratory record. - **Documentation** - A documentation page is a base object analogous to a simple note-taking page. - name: Scispot API - ELN API - Create - name: Scispot API - ELN API - Update - name: Scispot API - ELN API - Find - name: Scispot API - ELN API - List - name: Scispot API - ELN API - Delete - name: Scispot API - ELN API - Permissions (Super Admin Only) description: >- ### Permissions Endpoint These endpoint allows you to list, add, remove useres from a private folder. #### **Notes**: - The owner of the API token must have Super Admin permissions - These endpoints only work for folders that are already privated - name: Scispot API - MANIFESTS (PLATES, BOXES, RACKS) API description: |- #### Overview The following API calls are for the manipulation of manifest data. #### Terminology - **Manifest** - A visual representation of a well plate. - name: Scispot API - SEQUENCE API description: |- #### Overview The following API calls are for the manipulation of DNA sequence data. - name: Scispot API - FILES API - name: Scispot API - LOCATIONS API - name: Scispot API - LABFLOWS API - name: Scispot API - WEBHOOK API paths: /sequences/bulk: post: tags: - Scispot API - SEQUENCE API summary: Create Sequences in Bulk description: >- Create sequences of any type in bulk. This endpoint supports all sequence types. Each item in `sequences` requires a `name` and one of `sequence` | `sequenceData`; `type` (default DNA), `circular`, `description`, and `uuid` are optional per item. Note: feature arrays (features/parts/primers/guides/etc.) are not accepted here — canonical creation synthesizes empty feature sets. Use POST /sequences/{uuid}/annotations to add annotations afterward. parameters: [] requestBody: content: application/json: schema: type: object properties: sequences: type: array description: >- The list of sequences to create. Each entry is an independent sequence definition. items: type: object properties: name: type: string description: The name of the sequence to create. type: type: string description: >- The sequence type. Defaults to DNA. One of: DNA, RNA, OLIGO, PROTEIN (aliases PEPTIDE/AA/AMINO_ACID), MIXED. sequence: type: string description: >- The raw sequence content (e.g. bases or residues). Provide either `sequence` or `sequenceData`. sequenceData: type: string description: >- Alias for `sequence`; the raw sequence content. Provide either `sequence` or `sequenceData`. description: type: string description: (Optional) A free-text description of the sequence. circular: type: boolean description: >- (Optional) Whether the sequence is circular. Ignored (forced to false) for protein sequences. uuid: type: string description: >- (Optional) A client-supplied UUID to assign to this sequence. If omitted, one is generated. annotations: type: array description: >- (Optional) Feature annotations to seed on the sequence. items: type: object properties: id: type: string description: >- (Optional) A client-supplied identifier for the annotation. name: type: string description: The display name of the annotation/feature. start: type: integer description: >- The zero-based start position of the annotation on the sequence. end: type: integer description: >- The end position of the annotation on the sequence. color: type: string description: >- (Optional) A hex color used to render the annotation (e.g. type: type: string description: >- (Optional) The feature type (e.g. gene, CDS, primer). forward: type: boolean description: >- (Optional) The strand direction; true for the forward strand, false for the reverse strand. required: - name - start - end additionalProperties: true required: - name additionalProperties: true anyOf: - required: - sequence - required: - sequenceData required: - sequences additionalProperties: true example: sequences: - name: GFP Gene type: DNA sequence: ATGCGTAAAGGCGAGGAAC description: GFP coding sequence tracked in Sample Manager circular: false - name: AmpR type: DNA sequence: ATGAGTATTCAACATTTCCG description: Ampicillin resistance marker circular: false required: true responses: '200': headers: Content-Type: schema: type: string example: application/json content: application/json: schema: type: object properties: success: type: boolean sequences: type: array items: type: object properties: name: type: string success: type: boolean uuid: type: string type: type: string message: type: string additionalProperties: true additionalProperties: true example: success: true sequences: - name: GFP Gene success: true uuid: type: DNA - name: AmpR success: true uuid: type: DNA description: OK '401': description: Invalid Authentication Token content: application/json: schema: type: object properties: success: type: boolean example: false message: type: string additionalProperties: true example: success: false message: Invalid Authentication Token '403': description: Missing Authentication Token content: application/json: schema: type: object properties: success: type: boolean example: false message: type: string additionalProperties: true example: success: false message: Missing Authentication Token '422': description: Validation error content: application/json: schema: type: object properties: success: type: boolean example: false message: type: string additionalProperties: true example: success: false message: Validation error '500': description: Operation failed content: application/json: schema: type: object properties: success: type: boolean example: false message: type: string additionalProperties: true example: success: false message: Operation failed components: securitySchemes: bearerAuth: type: http scheme: bearer bearerFormat: UUID description: Personal access token from Scispot Account → Personal Tokens ```` This documentation is built and hosted on [Mintlify](https://mintlify.com), a developer documentation platform.